Introduction
Due to its natural condition, the soil is an environment conducive to a
vast diversity of organisms, such as fungi and bacteria. Part of these
microorganisms live in symbiosis with various species of plants, whether
cultivated or not, and which have potential for plant production (Javaid 2009;
Javaid and Mehmood 2010). Beneficial microorganisms such as actinomycetes,
common bacteria and filamentous fungi have been studied for agricultural
growth, making it possible to use their functions to develop processes. The
action of the soil microbiota confers benefits such as biological N fixation,
phosphate solubilization and biological control of phytopathogens and
agricultural pests, which has already been demonstrated in several studies
(Silva et al. 2017; Barros et al. 2019; Sharf et al. 2021). However, for the
maintenance of soil microbiota, vegetation and consequently their chemical
attributes, it is necessary to adopt conservation practices in view of the
cultivation system and plants adopted in the area/region. The Brazilian
Semiarid region has suffered from the exponential growth of environmental
degradation, especially with regard to the soil, where the changes suffered in
the landscape are observed, especially the damage caused by bad agricultural
practices (Nascimento et al. 2018). This huge degradation process has
been caused by the misuse of the same or of water, resulting in salinization,
desertification and reduction of biological diversity in many ecosystems and
agroecosystems, which has resulted in a constant concern with the recovery of degraded areas and
conservation of still resistant environments (Nascimento et al. 2018,
2021).
The semiarid vegetation is constituted by several plants, being the
Cactaceae considered endemic in this region. In this way, this botanical family
has been used as a resource for providing food, destined especially for
animals. On the other hand, the practice of conservation management in such
areas is deficient, leaving at the mercy of the plant species themselves the
maintenance of the propagation of descendants so that the species is
maintained, which causes another factor that provides the degradation processes
environmental (Prăvălie 2021). The investigation of soil
microorganisms with a view to prospecting for agricultural, pharmaceutical and
industrial purposes is constant and dynamic. Soil is understood as a living
compartment, housing a vast community of organisms, including fungi, which
have the ability to establish harmonious relationships with plants. However,
when it comes to studies related to the interactions between microorganisms and cactuses in the
semiarid region, most of the works have been focused on preserved areas (Silva et
al. 2019a), which means that real data are often not explored.
Given the importance of the relationships between this group of
microorganisms and plants, there is a certain interest to know the processes
related to them. Regarding to their agricultural, industrial and pharmaceutical
characteristics, there is ecological and economic importance. Therefore,
tools such as morphology are essential for the identification of these
microorganisms. However, at certain times, the morphology is not enough to
identify these organisms at the species level. Thus, molecular techniques
developed over the years from the Polymerase Chain Reaction (PCR), and DNA
sequencing have been of great value for the study and identification of
organisms (Khan and Javaid 2021, 2022a). Thus, among the molecular markers used
to identify fungi, the ITS region (Internal Transcribed Spacer) stands out,
which separates the 18S and 28S rDNA genes and can be amplified with primers
anchored to these two regions (Fungaro 2000). These regions have been used in
phylogenetic studies due to the fact that they are conserved among species and
with low variations at the genus level (Lee and Taylor 1992). This gene region
has been described by scientists in the study of soil fungal diversity. Berutti et al.
(2017) state that by using the ITS region it is possible to estimate the structure
of the microbial community of arbuscular mycorrhizal fungi as a function of
their environmental relationships. Schoch et al. (2012), studying
regions to identify soil living fungi, explain that the ITS region was more
successful in identifying these fungi. For Rittenour et al. (2014), the
ITS region provided greater accuracy in identifying fungi of the Ascomycota
phylum. There are many recent examples of using ITS marker for identification
of Pyricularia oryzae (Javaid et al. 2019), Curvularia lunata (Khan and Javaid 2020), Alternaria radicina (Javed and Javaid 2021), Penicillium echinulatum and Mucor fragilis (Khan and
Javaid 2022b, c).
It is imperative to consider the conservation and recovery of degraded
environments or those undergoing degradation processes of social and ecological
importance. Thus, the study of the population and microbial diversity of soils
in salinized and desertified areas are of paramount importance to foster data
that corroborate actions that contribute to their recovery processes,
especially for agrarian development. Therefore, the objective of this study was
to isolate and identify rhizospheric fungi associated with cacti from the
semiarid region of Alagoas, Brazil regarding their association with the
chemical attributes of the soil.
Materials and
Methods
Chemical attributes of the soil
Soil samples were collected at two points in the rural area of the
municipality of Ouro Branco-AL, Brazil, which were recorded using a Global
Processing System (GPS) equipment (Point A O: 37° 24' 45.9'' S: 9° 4' 47.3'';
Point B O: 37° 24' 51.0' S: 9° 4' 38.3''), in an area that is in the process of
desertification and salinization (Nascimento et al. 2018). In the area
there is an abandoned plantation of forage cactus (Opuntia cochenillifera),
and currently its propagation occurs spontaneously.
Isolation and estimative of fungal population
From each point samples were collected at a depth of 0–20 cm from the
surface layer of the rhizosphere of O. cochenillifera. The samples were
placed in brown paper bags, identified and sent to the laboratory for chemical and
biological analysis. For the isolation and counting of microorganisms, the
decimal serial dilution method was adopted, followed by inoculated on selective
microbial culture medium. Fungi were isolated by serial decimal dilution (10-3),
plating in Martin culture medium and incubated for five days to count the
colony forming units (CFU g-1) to estimate the population of fungi
associated with the rhizosphere of cacti and subsequent subculturing and
purification of the obtained isolates.
For the chemical analysis of the soil, the following parameters were
used: Mehlich-1 Extractor, 1.0 M
KCl Extractor, Ca acetate extractor at pH 7.0, Welkley-Black method, Base
saturation, and aluminum saturation. The data provided a comparison between
chemical and microbiological attributes for modeling the conditions of the area
in the process of desertification and salinization. Microbiological
data were subjected to analysis of variance using Sisvar software (Ferreira
2014), and the means were grouped by the Skott-Knott test at 5% level of
significance.
Morphomolecular characterization of fungal
isolates
For DNA extraction, the strains were grown in potato dextrose (BD)
culture medium and after five days the mycelium was filtered and washed in
sterile distilled water and put to dry at room temperature. Afterwards,
maceration of a fragment of the mycelial mass in liquid N was performed, and
later, extraction was performed by adding 1 mL of CTAB buffer (2%), and 2 µL of 2% β-mercapto-methanol.
The liquid obtained was transferred to 2 mL microtubes and placed in a water
bath for 30 minutes at 65ºC, followed by centrifugation at 13000 rpm for 5
minutes and 4ºC.
The supernatants were transferred to new 1.5 mL microtubes and an equal
volume of chloroform-isoamyl alcohol (24:1 v/v) was added to the recovered
supernatant, homogenized and centrifuged at 13,000 rpm for 10 min. Again
supernatants were transferred to other microtubes and equal volumes of ice-cold
isopropanol added. The system was kept at -20ºC for 1 h. Then the microtubes
were centrifuged at 13,000 rpm for 10 min. The precipitated DNA was washed with
70% ethanol and 50 μL of Ultrapure
water was added. After extraction, electrophoresis was performed to confirm the
existence of DNA.
The PCR reaction was performed to amplification of ITS1 and ITS4 regions
from rDNA in total volume of 30μL using the
Taq DNA polimerase buffer 1X, 1,5 mM
of MgCl 2; 0,4 μM of each primer ITS1 (5’ – TCCGTAGGTGAACCTGCGG – 3’) and ITS4 (5’ –
TCCTCCGCTTATTGATATGC – 3’), 0,2 mM of
dNTPs, and 0, 2 U of Taq DNA polimerase, and 25ng of the extracted DNA.
PCR was performed in an Applied Biosystems Thermocycler (2720 Thermal
Cycler) under the following conditions: initial denaturation was 95°C for 2
min, followed by 38 cycles of denaturation at 95°C for 1 min, annealing a 55°C
for 30s, extension at 72°C for 45 s, and a final extension at 72°C for 10 min.
PCR products were separated by 1.0% agarose gel electrophoresis with 1X Tris
Borate EDTA, stained with ethidium bromide (5 mg mL-1) and
visualized in a UV transilluminator.
After amplification the products were sent to Magrogen® for sequencing,
which was performed using the Sanger technique. The chromatograms obtained from
the PCR products of the sequences were visualized, analyzed and edited using
the Staden Package software (to obtain the consensus sequence), and aligned
using the MUSCLE tool (Edgar 2004), implemented by the MEGA v. 6 program
(Tamura et al. 2013; Kumar et al. 2018). Sequences from previous
studies, available at GenBank (https://www.ncbi.nlm.nih.gov/genbank) (Table 1)
were retrieved and contrasted by the BLASTn tool and included in the analyzes
for similarity comparison, where they were those with proximity > 99% were
adopted. The Metarhizium anisopliae fungus was adopted as an outgroup.
The construction of the phylogenetic tree was carried out by adopting
the Neighbor-Joining method, which consists of finding pairs of operational
taxonomic units aiming to minimize the total length of the branch at each stage
of phylogenetic grouping (Saitou and Nei 1987). In addition, the morphological
characteristics were compared to confirm the inferences related to the species,
according to morphological identification keys according to Luz and Inácio
(2009).
Results
A fungal population of
8.6 × 103 CFU g-1 was obtained for the first collection
point (Point A), which has a deactivated well due to the advanced salinization
process. At the second collection point, a population of 9.4 x 103
UFC g-1 was obtained, which corresponds to an abandoned agricultural
area, where there had been corn cultivation for years, but without success in
production, currently existing populations of O. cochenillifera and
other species of spontaneously growing cacti. The data obtained for the
microbial populations of the two areas did not differ statistically by the
Skott-Knott test (P ≤ 0.05).
Data from the rhizospheric microbial community associated with cactuses
from the semiarid region of Alagoas, Brazil show that they follow the impacts
suffered by the soil in the same way, that is, degraded environments, although
they present their considerable microbial populations (filamentous fungi,
common bacteria and actinomycetes), they have a decline in these communities,
which is related to their chemical attributes.
Thus, the soil analyzes (Table 2) showed high Na+ values,
observing a Percentage of Exchangeable Sodium (PES) of 6.27 for Point B and
17.34 for Point A, where a deactivated well is located. Therefore, it is
understood that, although at points relatively close to each other, the soil
attributes present differences, which may be based on the fact that soil
drilling causes elevation and release of sodium and other salts that were in
depth, making it the free ones in the arable layer, which with inadequate
agricultural management, regarding the efficiency of water use, provided
acceleration in the soil salinization process. Thus, it is possible to state
that the soil in the region under study has a sodic saline character (PES > 15;
pH 5.2).
Furthermore, the region also has low levels of organic matter (10.6 g kg-1
for Point A and 15.5 g kg-1 for Point B). Therefore, this characteristic
contributes to the low microbial population, since the low content of organic
matter makes the availability of nutrients for cell development and
multiplication of microorganisms scarce. Therefore, it also explains the fact
that there is a greater population of filamentous fungi, as they have
resistance structures (spores) which gives them greater ability to survive in
an environment without water and organic matter. Furthermore,
filamentous fungi can have a symbiotic character such as mycorrhizae, with a
certain affinity for colonization of the root system of plants.
The species presented here (Fig. 1) have been described in previous
studies, being isolated from the most distinct environments, such as Penicillium,
which has been described in the literature for promoting plant growth, either
through the production and synthesis of hormones vegetables such as
gibberellins or through indirect mechanisms that act on plant nutrition, such
as phosphate solubilization.
Table 1: Chemical attributes of the soil collected at two points
in the municipality of Ouro Branco, Alagoas, Brazilian Semiarid
|
Determinations |
Point A |
Point B |
|
pH in water |
5.2 |
5.8 |
|
Na (mg dm-3) |
10 |
5 |
|
P (mg dm-3) |
11 |
25 |
|
K (mg dm-3) |
58 |
75 |
|
Ca (cmolc
dm-3) |
1.32 |
1.32 |
|
Mg (cmolc
dm3) |
0.72 |
0.97 |
|
Al (cmolc
dm3) |
0 |
0.05 |
|
H + Al (cmolc
dm-3) |
3.39 |
2.43 |
|
CEC*
efective (cmolc dm-3) |
2.34 |
2.55 |
|
CEC total
(cmolc dm-3) |
2.62 |
4.93 |
|
MO** (g kg-1) |
10.6 |
14.5 |
|
V*** (%) |
40 |
51 |
|
m (%) |
5 |
2 |
|
Ca
saturation (%) |
23.5 |
26.8 |
|
Mg
saturation (%) |
12.8 |
19.7 |
|
K saturation
(%) |
2.7 |
3.9 |
|
Na
saturation (%) |
0.7 |
0.4 |
*CEC: cation exchange capacity; **OM: Organic
Matter; ***V: Base saturation
%20371-380_files/image002.png)
Fig. 1: Morphology of
fungi isolated from cacti rhizosphere. A: Penicillium spp., B: Aspergillus
spp., C: Coprinellus radians, D: Aspergillus spp., E, Neurospora
spp., F: Coprinellus radians, G: Aspergillus spp., H: Penicillium
spp., I: Paecilomyces spp., J: Penicillium spp., K: Paecilomyces
spp.; A1: Penicillium spp., B1: Aspergillus spp., C1: Coprinellus
radians, D1: Aspergillus spp., E1, Neurospora spp., F1: Coprinellus
radians, G1: Aspergillus spp., H1: Penicillium spp., I1: Paecilomyces
spp., J1: Penicillium spp, K1: Paecilomyces spp.
Red arrows indicate spores and/or conidia. Based on the results
obtained, the genus Coprinus (Coprinellus) (Agaricales: Psathyrellaceae)
can be confirmed for isolates F05 and F09 through phylogenetic inference (100%)
(Fig. 2) and morphology, as well as compared to studies already published as
Huang and Bau (2020), where morphogenetic similarities can be verified. Isolates
F02, F11 and F15 also showed agreement between morphology and phylogenetic
inference.
Isolates F04, F10 and F07 were similar to the genus Aspergillus
(Eurotiales: Trichocomaceae). For isolates F14 and F17, the phylogenetic
correspondence comprised the grouping of the genus Paecilomyces (Sin. Purpureocillium)
(Eurotiales: Trichocomaceae), which is a polyphyletic genus, as pointed out by
Luangsa et al. (2004), occurring in the subclasses Sordariomycetidae and
Eurotiomycetidae. This genus has been described in the literature as an
important biocontrol agent, more specifically as a nematophagus acting in the
integrated pest management, and may be a strong candidate in the production of
bioinputs for agricultural development.
Isolate F08 corresponded to the genus Neurospora
(Saccharomycetes: Sordariales). This filamentous ascomycete fungus is an
important eukaryote, being understood as a model organism in biological studies
in various areas such as health and biotechnology.
Table 12: Retrieved isolates from GenBank for phylogenetic analisys of ITS from
rDNA
|
Isolate |
Species/Genera |
Place |
GenBank |
|
F02 |
Penicillium spp. |
Brazil |
OK210351 |
|
F04 |
Aspergillus spp. |
Brazil |
OK210353 |
|
F05 |
Coprinellus radians |
Brazil |
OK210350 |
|
F07 |
Aspergillus spp. |
Brazil |
OK210342 |
|
F08 |
Neurospora spp. |
Brazil |
OK178929 |
|
F09 |
Coprinellus
radians |
Brazil |
OK178928 |
|
F10 |
Aspergillus spp. |
Brazil |
OK210345 |
|
F11 |
Penicillium spp. |
Brazil |
OK210326 |
|
F14 |
Paecilomyces spp. |
Brazil |
OK210352 |
|
F15 |
Penicillium spp. |
Brazil |
OK210344 |
|
F17 |
Paecilomyces spp. |
Brazil |
OK210347 |
|
HURB 18573 |
Penicillium spp. |
Brazil |
NR172038 |
|
974-SAB SP2 2 |
Penicillium spp. |
Brazil |
MT820349 |
|
439010 |
Penicillium spp. |
USA |
MW313849.1 |
|
BFM-L104 |
Paecilomyces
lilacinus |
China |
AB369489 |
|
YCG1(1) |
Aspergillus spp. |
China |
KM268709 |
|
UFMGCB10058 |
Coprinellus
radians |
Brazil |
KU954342 |
|
HCH-13 |
Coprinellus spp. |
México |
MK307658 |
|
PanB1A |
Coprinellus
radians |
Panamá |
JQ922136 |
|
URM7046 |
Aspergillus
niveus |
Brasil |
KM613137 |
|
CGMCC_3.03920 |
Aspergillus
allahabadii |
China |
MH292843 |
|
MS-Deb-PCB |
Aspergillus allahabadii |
India |
MN339985 |
|
isolate 80 |
Neurospora spp. |
South Africa |
KY587330 |
|
isolate PG2 |
Neurospora spp. |
South Africa |
KY606539 |
|
B65-ITS1_K18 |
Coprinellus
radians |
Saudi Arabia |
MN753979 |
|
SZ211 |
Aspergillus
versicolor |
China |
MH509421 |
|
MEFC092 |
Aspergillus spp. |
China |
MK732127 |
|
3-F9 |
Aspergillus versicolor |
China |
MW081327 |
|
RCZ2D-2 |
Penicillium daleae |
Niger |
MW260092 |
|
KP1 |
Penicillium spp. |
India |
JQ387731 |
|
M1861 |
Paecilomyces
formosus |
USA |
KC157764 |
|
Yu2-2 |
Paecilomyces spp. |
China |
MG827159 |
|
2723 |
Paecilomyces
sinensis |
Colombia |
EU272527 |
|
RHi |
Penicillium
janthinellum |
Malaysia |
KM246752 |
|
DTO 249-D2 |
Penicillium
raperi |
Netherlands |
KC797647 |
|
XI19 |
Penicillium spp. |
China |
KX008645 |
|
KVL 96-31** |
Metarhizium
anisopliae |
Greece |
AF363470.1 |
*CEC: cation exchange capacity; **OM: Organic Matter; ***V: Base
saturation
Discussion
Soils in semiarid regions have, by nature, higher levels of sodium, a
characteristic explained by the low presence of primary minerals, which is
caused by low weathering. It was possible to observe the presence of some
fungal species, which have biotechnological potential for agriculture. Also,
the first report of the presence of the Coprinellus
fungus for the region is highlighted. Studies have shown the wealth of fungi
associated with plants from dry environments, stimulating the prospecting of
these microorganisms with typical vegetables from arid and semiarid habitats
(Freire et al. 2015). In the present study, 11 morphologically distinct
isolates were obtained, making it possible to identify the genera: Aspergillus,
Penicillium, Paecilomyces, Neurospora and Coprinellus,
making it necessary to identify the isolates obtained through molecular
techniques to confirm the species. These genera were also described by Freire et
al. (2015) in cactus species, however living as endophytes. Although there
are reports of microbial species in association with the most diverse species
of cacti, previous studies are centered on endophyte interactions (Bezerra
2013; Freire et al. 2015), that is, there is still a need for more
studies on rhizospheric microorganisms that live in associations with cacti.
For Six et al. (2004), there are five main factors responsible for the
stabilization of soil aggregates, with microorganisms being the second most
characteristic group. Thus, saprophytic fungi, mycorrhizae and bacteria are relevant
factors for soil aggregation (Braida et al. 2011).
%20371-380_files/image004.png)
Fig. 2: Phylogenetic
tree of maximum like hood (1000 bootstraps) of the sequencing from rDNA ITS
(ITS1 and ITS4) in comparison to sequences retrieved from GenBank
The establishment of soil
microbial life in a given area is mainly influenced by physical and chemical
factors such as temperature, pH, luminosity, salinity, energy sources and
organic substrates (organic matter), nutrients and the presence or absence of toxic
elements. Thus, the different types of soil management exercised can interfere
with these factors, changing the microbial population and its activity (Araújo et
al. 2016; Silva et al. 2019b). In this aspect, as demonstrated by
Nascimento et al. (2018) the anthropic action is a limiting factor
regarding the characterization of the areas, as inadequate agricultural
practices provided the exponential growth of the desertification process,
reducing the botanical diversity and, consequently, the diversity of other
organisms and soil microorganisms.
Analyzing the previous literature on the occurrence of rhizospheric
fungi associated with cacti, the lack of research in this line is still
noticeable, with few publications available. Thus, the recently published works
address the isolation and identification of fungal species and genera in
association with cacti from the rhizosphere or endophyte associations (Bezerra
2013).
Even so, these works report the fungus-cactus association in areas
favorable to the development of these microorganisms, as they are studies
carried out in conserved areas or in ecological reserves. Thus, it is important
to emphasize the importance of studies aimed at prospecting and characterizing
the population and microbial diversity in arid and semi-arid environments in
view of the growing needs of increasing plant production.
Another relevant point is the need to encourage actions in programs for
the recovery and conservation of degraded areas, with knowledge of microbial
diversity being an important aspect, as these microorganisms have
biotechnological potential capable of promoting improvements in this aspect.
Furthermore, in ecological terms, the interaction between plants and
microorganisms creates numerous advantages for both, as well as for the
environment, through the cycling of nutrients and organic matter, suppression
of pathogens and pests, among others.
Universal primers such as those used in the present study are more
commonly applied in amplifying these regions (White et al. 1990). The
similarity presented here is proposed according to what other works show, as
exemplified by Nilsson et al. (2008), where the authors state that 2% is
an acceptable margin for the study of intraspecific divergence through the ITS
region. Paul et al. (2013) where this fungus shows changes in the color
of the culture medium and the similarity in their reproductive structures,
being grouped in branches corresponding to species of the genus Penicillium
(Eurotiales: Trichocomaceae).
Coprinellus is understood as a coprinoid fungus, of which they are currently
distributed in four genera: Coprinus Pers 1797, Coprinellus P.
Karst., Coprinopsis P. Karst and Parasola Vilgalys & Hopple. These
fungi underwent an adaptive process, which refers to a morphotype that emerged
during the evolution of the order Agaricales, characterized by the
deliquescence of the hymenophore and cap as part of the sporulation process,
accompanied by the presence of pseudo paraphyses and hymenium development (Nagy
et al. 2011). The fungi grouped as in the taxonomic class Eurotiomycetes
(Eurotiales: Trichocomaceae), can be described by their characteristics as
having superficial, free and rounded cleistothecia. Its conidia can be
filamentous or branched into chains (Luz and Inácio 2009).
Moreno-Gavíra et al. (2020) describe the mechanisms by which Paecilomyces
species act as plant growth promoters, with their ability to combat
phytopathogenic agents such as bacteria (Xanthomonas campestris), fungi
(Biscogniauxia, Phytophthora cinnamomi, P. variotii and Fusarium
moniliforme) and nematodes (Rotylenchulus, Heterodera, Xiphinema,
Pratylenchus and Meloidogyne). Also according to the authors, the
action of these fungi can occur through direct antagonism (antibiosis) or
through the induction of systemic resistance, providing an increase in the
biometric characteristics of plants inoculated with P. lillacinus.
Species belonging to the genus Penicillium have also been
described as resistance inducers in plants as demonstrated by Elsharkawy et
al. (2017), who found that a species of Penicillium has the ability
to induce resistance against Cucumber Mosaic Virus in tobacco plants.
Hossain et al. (2014) found that Penicillium spp. promotes plant
growth in cucumber plants and protection against Damping-off caused by
Rhizoctonia solani and anthracnose caused by Colletotrichum orbiculare
in cucumber plants inoculated with Penicillium spp. isolated, which
demonstrates that the species have high adaptability.
According to studies carried out by Gladieux et al. (2020),
Neurospora species act as a genetic basis for studies in Eukaryotes. Macabeo et
al. (2020) state that compounds of pharmaceutical and industrial interest
were isolated from species of the Neurospora genus and show activity against
pathogenic fungi, being the first report describing N. dagawae
metabolites.
The genus Coprinus
(which currently houses the species of Coprinellus spp.) in turn is
comprised within the phylum Basidiomycota, and has greater potential for
pharmaceutical and industrial application. Previous studies have shown that
species within this genus are capable of producing several enzymes, as
described by Pejin et al. (2019), where the authors state that Coprinus
spp. have a high potential for acetylcholinesterase inhibitory activity.
Lim and Choi (2009), studying C. congregatus, state that the
fungus has high chitinase enzymatic activity. Plantay et al. (2019),
when isolating infected soil fungi and soil arthropods, they also found the
genus Coprinus, which makes a parallel with the aforementioned authors,
since this enzyme is an indicator for the use of fungi in the biological
control of pest insects.
In Brazil, coprinoid fungi (Coprinus and Coprinellus) were
first recorded in Mato Grosso (Pegler 1990). In other states, there are records
in Rondônia (Capelari and Maziero 1988), São Paulo (Pegler 1997), Paraná
(Meijer 2010), Mato Grosso do Sul (Richardson 2001), Minas Gerais (Rosa and
Capelari 2009), and Pernambuco (Alves and Cavalcanti 1996). The most recent
records correspond to the states of Paraíba (Gomes and Wartchow 2014, 2018),
Ceará (Gomes and Wartchow 2018) and Pernambuco (Melo et al. 2016).
According to data published by Putzke and Putzke (2017), 64 species are
registered in Brazil. Based on the data, the first occurrence of these fungi in
the state of Alagoas is registered here.
The genus Penicillium receives species of agricultural interest
as plant growth promoters, as well as for the pharmaceutical industry through
its diversity in volatile compounds. Hossain et al. (2017) describe in
their studies the role of the fungus P. viridicatum in ethylene
signaling, acting as plant growth promoter and systemic resistance inducer in Arabdopsis
plants.
This genus has been reported, as described by Yadav et al. (2018)
in different habitats, including extreme environments, in plants, as well as in
rotten fruits and vegetables due to the saprophytic character of some species
of the genus. Penicillium isolated from extreme environments can be used
to understand the adaptive processes that allow life in these types of
environments as far as their evolutionary processes are concerned. Evidence of
its existence in diverse habitats has consequences for the exploration of
promising biotechnological and industrial applications.
Research on the composition of the rhizosphere microbiome is becoming
more relevant from the perspective of understanding plant-microbe interactions
based on ecosystem services and plant adaptation in stressful environments in
climate change and food security scenario (Adl 2016; Ahkami et al.
2017). These microorganisms play a significant role in plant biogeography,
evolution and ecosystem structure. Microbial communities associated with the
host influence ecophysiology with regard to nutrition, growth, resistance to
biotic and abiotic stresses, and the survival and distribution of plant species
(Rey and Schornack 2013; Wani et al. 2015), which reinforces the need to
intensify studies aimed at rhizospheric fungi associated with cacti, especially
in environments in the process of degradation.
In addition to the classic tools for isolation and identification of
soil microorganisms, molecular techniques such as rDNA ITS sequencing are
efficient in identifying these fungi, making it possible to infer their
diversity and distribution. Therefore, based on the results and theoretical
support of the previously published literature (Schoch et al. 2012;
Rittenour et al. 2014; Berutti et al. 2017) it is possible to
state that in the semi-arid Northeast, more specifically in the state of Alagoas,
Brazil, there is diversity associated with the rhizosphere of cacti in an area
undergoing desertification and salinization.
Conclusion
The species found in the study, according to genetic sequencing and
comparison in the literature, have different origins, from the association with
marine algae as endophytes in cultivated plants such as coconut and cocoa,
which demonstrates high plasticity in terms of adaptation to the environment.
The sequencing of the ITS region of the rDNA of filamentous fungi associated
with the rhizosphere of cacti allows the identification of potential species
for biotechnological applications. Here we have the first record of the genus
Coprinellus in the semiarid region of the state of Alagoas, Brazil.
Acknowledgements
The authors are grateful to the Coordination for the Improvement of
Higher Education Personnel (CAPES) for the financial support for carrying out
the research.
Author Contributions
All authors contributed equally to this work
Conflicts of Interest
The authors declare no conflicts of interest.
Ethics Approval
Not applicable in this paper
References
Adl SM (2016).
Rhizosphere, food security, and climate change: A critical role for plant-soil
research. Rhizosphere 1:1–3
Ahkami AH, RA White
III, PP Handakumbura, C Jansson (2017) . Rhizosphere engineering: Enhancing
sustainable plant ecosystem productivity. Rhizosphere 3:233–243
Alves MH, MAQ Cavalcanti (1996).
Coprinaceae en el campus de la Universidad Federal de Pernambuco (Recife, PE,
Brasil). Bol Micol 11:33–40
Araújo KD, MA Souza, GR Santos, AP
Andrade, JVF Neto (2016). Atividade microbiana no solo em diferentes ambientes
da região semiárida de alagoas. Geografia 25:5–18
Barros VDC, MAL Junior, MVF Santos, AF
Costa, AM Arruda, CA Sousa (2019). Diversidade rizobiana em função de solo e
clima no semiárido pernambucano. Pesq Agropec Pernamb 24:1–6
Berruti A, A Desirò, S Visentin, O
Zecca, P Bonfante (2017). ITS fungal barcoding primers versus 18S AMF-specific
primers reveal similar AMF-based diversity patterns in roots and soils of three
mountain vineyards. Environ Microbiol Rep 9:658–667
Bezerra JDP (2013).
Diversidade de fungos endofíticos de mandacaru (Cereus jamacaru DC., Cactaceae) em áreas sucessionais de Caatinga.
Dissertação (Mestrado em Biologia de Fungos), Universidade Federal de
Pernambuco, Recife
Braida JA, C Bayer, JA Albuquerque, JM
Reichert (2011). Matéria orgânica e seu efeito na física do solo. In: Tópicos
em Ciência do Solo, Vol. VII, pp:221–278. Klauberg Filho O. Sociedade
Brasileira de Ciência do Solo
Capelari M, R Maziero (1988). Fungos
macroscópicos do estado de Rondônia região dos Rios Jaru e Ji-Paraná. Hoehnea 15:28–36
Edgar RE
(2004). MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucl Acid Res 32:1292–1297
Elsharkawy MM,
JM Abass, SM Kamel, M Hyakumashi (2017). The plant growth promotin fungi Penicillium spp. GP16-2 enhace the
growth and confers protection against Cucumber mosaic vírus in tobacco. J
Virol Sci 1:145–154
Ferreira DF
(2014). Sisvar: A guide for its Bootstrap procedures in multiple comparisons. Ciênc
Agrotecnol 38:109–112
Freire KTLS, GR Araújo, JPD Bezerra,
RN Barbosa, DCV Silva, VM Svedese, LM Paiva, CM Souza-Mota (2015). Fungos
endofíticos de Opuntia Ficus-indica
(L.) Mill.(Cactaceae) sadia e
infestada por Dactylopius opuntiae
(Cockerell, 1896) (Hemiptera: Dactylopiidae). Gaia Sci 9:104–110
Fungaro MHP (2000). PCR na micologia. Biotecnol
Ciênc Desenvol 14:1216
Gladieux P, F
Bellis, C Hann-Soden, J Svedberg, H Johannesson, JW Taylor (2020). Neurospora
from natural populations: Population genomics insights into the life history of
a model microbial eukaryote. In: Statistical Population Genomics,
pp:313–336. Dutheil JY (Ed). Springer, New York, USA
Gomes ARP, F
Wartchow (2018). Notes on two coprinoid fungi (Basidiomycota, Agaricales) from
the Brazilian semiarid region. Edinb J Bot 75:285–295
Gomes ARP, F
Wartchow (2014). Coprinellus arenicola, a new species from Paraíba,
Brazil. Sydowia 66:249–256
Hossain M, F
Sultana, M Hyakumachi (2017). Role of ethylene signalling in growth and
systemic resistance induction by the plant growth-promoting fungus Penicillium
viridicatum in Arabidopsis. J Phytopathol 165:432–441
Hossain M, F
Sultana, M Miyazawa, M Hyakumach (2014). The Plant Growth-promoting Fungus Penicillium spp. GP15-1 Enhances Growth
and Confers Protection against Damping-off and Anthracnose in the Cucumber. J
Oleo Sci 63:391–400
Huang M, T Bau
(2020). New findings of Coprinellus species (Psathyrellaceae, Agaricales) in
China. Phytotaxa 374:119–128
Javaid A
(2009). Arbuscular mycorrhizal mediated nutrition in plants. J Plant Nutr 32:1595–1618
Javed S, A Javaid (2021). First report of black rot of carrot caused by Alternaria radicina in Pakistan. J Anim Plant Sci 31:1208–1211
Javaid A, N Mahmood (2010). Growth, nodulation
and yield response of soybean to biofertilizers
and organic manures. Pak J Bot 42:863–871
Javaid A, F Anjum, N Akhtar (2019). Molecular characterization of Pyricularia
oryzae and its management by stem extract of Tribulus terrestris. Intl J
Agric Biol 21:1256–1262
Khan IH, A Javaid (2022a). Molecular characterization of Penicillium italicum causing blue mold on lemon in Pakistan. J Plant Pathol 48:1–2
Khan IH, A Javaid (2022b). Penicillium
echinulatum causing blue mold on tomato in Pakistan. J Plant Pathol 102:1–1
Khan IH, A Javaid (2022c). Mucor
fragilis causing rot of seychelles pole bean in Pakistan. Aust Plant Pathol 76:1–4
Khan IH, A Javaid (2021). Molecular characterization of Penicillium
expansum associated with blue mold disease of apple
in Pakistan. Pak J Bot 53:2299–2303
Khan IH, A Javaid (2020). First report of Curvularia lunata causing postharvest fruit rot of banana in
Pakistan. Intl J
Agric Biol 24:1621–1624
Kumar S, G
Stecher, K Tamura (2018). MEGA7: Molecular Evolutionary Genetics Analysis
across computing platforms. Mol Biol Evol 35:1547–1549
Lee SB, JW
Taylor (1992). Phylogeny of five fungus-like protoctistan Phytophthora species,
inferred from the internal transcribed spacers of ribosomal DNA. Mol Biol
Evol 9:683–653
Lim H, HT Choi (2009). Enhanced expression of chitinase during the
autolysis of mushrooms in Coprinellus
congregatus. J Microbiol 47:225–228
Luangsa J, NL
Hywel-Jones, RA Samson (2004). The polyphyletic nature of Paecilomyces sensu
lato based on 18S-generated rDNA phylogeny. Mycologia 96:773–780
Luz WC, CA Inácio (2009). Micologia
Avançada. Volume IIA: taxonomia de ascomicetos. Revisão Anual de
Patologia de Plantas: São Paulo, Brazil
Macabeo APG, AJC Cruz, A Narmani, M
Arzanlou, A Babai-Ahari, LAE Pilapil, KYM Garcia, M Stadler (2020). Tetrasubstituted α-pyrone derivatives from the endophytic fungus, Neurospora
udagawae. Phytochem Lett 35:147–151
Meijer AAR
(2010). Preliminary list of the macromycetes from the Brazilian state of
Paraná: Corrections and updating. Bol Mus Bot Munic 72:1–9
Melo RFR, RS
Chickowski, AN Miller, LC Maia (2016). Coprophilous Agaricales (Agaricomycetes,
Basidiomycota) from Brazil. Phytotaxa 266:1–14
Moreno-Gavíra A, V Huertas, F Diánez,
B Sánchez-Montesinos, M Santos (2020). Paecilomyces and its importance in the biological control of agricultural Pests and
diseases. Plants 9:1746–1773
Nagy LG, G
Walther, J Házi, C Vágvölgyi, T Papp (2011). Understanding the evolutionary
processes of fungal fruiting bodies: Correlated evolution and divergence times
in the psathyrellaceae. Syst Biol 60:303–317
Nascimento CM, WS Mendes, NEQ Silvero,
RR Poppiel, VM Sayão, AC Dotto, NV Santos, MTA Amorim, JAM Demattê (2021). Soil
degradation index developed by
multitemporal remote sensing images, climate variables, terrain and soil attributes.
J Environ Manage 227:111316
Nascimento SPG, JM Silva, EO Santos,
PVM Silva, JRU Santos, TMC Santos (2018). Impactos ambientais da produção
vegetal no processo de desertificação do Semiárido alagoano: O caso de Ouro
Branco – AL. Ciênc Agríc16:31–35
Nilsson RH, E
Kristiansson, M Ryberg, N Hallenberg, KH Larsson (2008). Intraspecific ITS
variability in the kingdom fungi as expressed in the internal sequence
databases and its implications for molecular species identification. Evol
Bioinform 4:193–201
Paul NC, JX
Deng, JH Lee, SH Yu (2013). New records of endophytic Paecilomyces inflatus
and Bionectria ochroleuca from chili pepper plants in Korea. Microbiology
41:18–24
Pegler DN
(1997). The Agarics of São Paulo, Brazil, p:70. Royal Botanical Gardens,
Kew, London
Pegler DN
(1990). Agaricales of Brazil Described by JPFC Montague. Kew Bull 45:161–177
Pejin B, K
Tesanovic, D Jakovljevic, S Kaisarevic, F Sibul, M Raseta, M Karaman (2019).
The polysaccharide extracts from the fungi Coprinus
comatus and Coprinellus truncorum
do exhibit AchE inhibitory activity. Nat Prod Res 33:750–754
Plantay RL, D
Papura, C Couture, D Thiéry, PH Pizzuolo, MV Bertoldi, GS Lucero (2019).
Characterization of entomopathogenic fungi from vineyards in Argentina with
potential as biological control agents against the European grapevine moth Lobesia botrana. BioControl
64:501–511
Prăvălie
R (2021). Exploring the multiple land
degradation pathways across the planet. Earth-Sci Rev 220:103689
Putzke J, MTL
Putzke (2017). Cogumelos (Fungos Agaricales) no Brasil. Jair Putzke, e-book
Rey T, S
Schornack (2013). Interactions of beneficial and detrimental root-colonizing
filamentous microbes with plant hosts. Genom Biol 14:121–126
Richardson MJ
(2001). Coprophilous fungi from Brazil. Braz Arch Biol Technol
44:283–289
Rittenour WR, JH
Park, JM Cox-Ganser, DH Beezhold, BJ Green (2014). Internal transcribed spacer
rRNA gene sequencing analysis of fungal diversity in Kansas City indoor
environments. Environ Sci Proc Imp 14:766–774
Rosa LH, M Capelari
(2009). Agaricales Fungi from atlantic rain forest fragments in Minas Gerais,
Brazil. Braz J Microbiol 40:846–851
SaitouN, M Nei
(1987). The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Mol Biol Evol 4:406–425
Schoch CL, KA
Seifert, S Huhndorf, V Robert, JL Spouge, CA Levesque, W Chen, FB Consortium
(2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a
universal DNA barcode marker for fungi. Proc
Natl Acad Sci 109:6241–6246
Sharf W, A Javaid, A Shoaib, IH Khan (2021). Induction of resistance in chili against Sclerotium rolfsii by plant growth promoting rhizobacteria and Anagallis arvensis. Egypt J Bioll
Pest Cont 31:16-26
Silva JM, CCN Cristo, YC Montalto, CS
Silva, EOA Sena, RB Vigoderis, GSP Barroso, JS Brito Neto, JUL Oliveira, TMC
Santos (2019a). Atividade e população microbiana de um podzólico vermelho
amarelo sob sistemas de cultivo orgânico e convencional de Citrus sinensis (L.) Osbeck. Rev Ciênc Agrár 42:340–346
Silva JM, SPG Nascimento, RTR Massahud,
TMC Santos, GSA Lima (2019b). Atributos químicos e biológicos do solo: Um
estudo no Semiárido Alagoano. In: Ensaios Interdisciplinares em Ciências
agrárias no Nordeste do Brasil, pp:42–80. Gomes IA. Itacaiúnas,
Ananindeua
Silva JM, RRO Teixeira, JR Rocha, TMC
Santos (2017). In vitro and in vivo antagonism of Screrotium
rolfsii Sacc by strains of Trichoderma
spp. Intl J Agric Environ Biores 2:60–67
Six J, ET
Bossuyt, S Degryzr, K Dene (2004). A history of research on the link between
(micro) aggregates, soil biota, and soil organic matter dynamics. Soil Till Res 79:7–31
Tamura K, G Stecher,
D Peterson, A Filipski, S Kumar (2013). MEGA6: Molecular Evolutionary Genetics
Analysis version 6.0. Mol Biol Evol 30:2725–2729
Wani ZA, N
Ashraf, T Mohiuddin, S Riyaz-Ul-Hassan (2015). Plant-endophyte symbiosis, an
ecological perspective. Appl Microbiol Biotechnol 99:2955–2965
White TJ, T
Bruns, S Lee, J Taylor (1990). Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetic. PCR Protoc Guide Meth Appl,
pp:315–322. Innis MA (Ed.) Academic Press, San Diego, California, USA
Yadav AN, P
Verma, V Kumar, P Sangwan, S Mishra, N Panjiar, AK Saxena (2018). Biodiversity
of the Genus Penicillium in Different Habitats. In: New and Future Developments in Microbial Biotechnology and
Bioengineering, pp: 3–18. Gupta VG, S Rodriguez-Couto (Eds). Elsevier
Publishers, London